BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Eche_v2.0_cds.fasta 30,099 sequences; 37,600,338 total letters Query= Untitled_sequence Length=20 Score E Sequences producing significant alignments: (Bits) Value Erche03g027020.1.mRNA1.mrna1gene=Erche03g027020.1.mRNA1 38.1 4e-04 Erche08g001260.1.mRNA1.mrna1gene=Erche08g001260.1.mRNA1 27.0 0.84 Erche07g006690.1.mRNA1.mrna1gene=Erche07g006690.1.mRNA1 27.0 0.84 Erche07g007640.1.mRNA1.mrna1gene=Erche07g007640.1.mRNA1 27.0 0.84 Erche07g023590.1.mRNA1.mrna1gene=Erche07g023590.1.mRNA1 27.0 0.84 Erche06g003790.1.mRNA1.mrna1gene=Erche06g003790.1.mRNA1 27.0 0.84 Erche05g036250.1.mRNA1.mrna1gene=Erche05g036250.1.mRNA1 27.0 0.84 Erche03g021430.1.mRNA1.mrna1gene=Erche03g021430.1.mRNA1 27.0 0.84 Erche03g031780.1.mRNA1.mrna1gene=Erche03g031780.1.mRNA1 27.0 0.84 >Erche03g027020.1.mRNA1.mrna1 gene=Erche03g027020.1.mRNA1 Length=6159 Score = 38.1 bits (20), Expect = 4e-04 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 CCGGTAAAGATCCACAACAT 20 |||||||||||||||||||| Sbjct 792 CCGGTAAAGATCCACAACAT 773 Score = 27.0 bits (14), Expect = 0.84 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 4 GTAAAGATCCACAACAT 20 ||||||||| ||||||| Sbjct 2232 GTAAAGATCGACAACAT 2216 >Erche08g001260.1.mRNA1.mrna1 gene=Erche08g001260.1.mRNA1 Length=2271 Score = 27.0 bits (14), Expect = 0.84 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 AAAGATCCACAACA 19 |||||||||||||| Sbjct 1273 AAAGATCCACAACA 1286 >Erche07g006690.1.mRNA1.mrna1 gene=Erche07g006690.1.mRNA1 Length=1326 Score = 27.0 bits (14), Expect = 0.84 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 3 GGTAAAGATCCACAACA 19 ||| ||||||||||||| Sbjct 325 GGTCAAGATCCACAACA 309 >Erche07g007640.1.mRNA1.mrna1 gene=Erche07g007640.1.mRNA1 Length=1995 Score = 27.0 bits (14), Expect = 0.84 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 6 AAAGATCCACAACA 19 |||||||||||||| Sbjct 721 AAAGATCCACAACA 708 >Erche07g023590.1.mRNA1.mrna1 gene=Erche07g023590.1.mRNA1 Length=2073 Score = 27.0 bits (14), Expect = 0.84 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 4 GTAAAGATCCACAACAT 20 ||||||||| ||||||| Sbjct 735 GTAAAGATCGACAACAT 719 >Erche06g003790.1.mRNA1.mrna1 gene=Erche06g003790.1.mRNA1 Length=4125 Score = 27.0 bits (14), Expect = 0.84 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 AAAGATCCACAACA 19 |||||||||||||| Sbjct 58 AAAGATCCACAACA 71 >Erche05g036250.1.mRNA1.mrna1 gene=Erche05g036250.1.mRNA1 Length=11346 Score = 27.0 bits (14), Expect = 0.84 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 6 AAAGATCCACAACA 19 |||||||||||||| Sbjct 4264 AAAGATCCACAACA 4251 >Erche03g021430.1.mRNA1.mrna1 gene=Erche03g021430.1.mRNA1 Length=5133 Score = 27.0 bits (14), Expect = 0.84 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 7 AAGATCCACAACAT 20 |||||||||||||| Sbjct 4698 AAGATCCACAACAT 4685 >Erche03g031780.1.mRNA1.mrna1 gene=Erche03g031780.1.mRNA1 Length=1197 Score = 27.0 bits (14), Expect = 0.84 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 GGTAAAGATCCACA 16 |||||||||||||| Sbjct 1123 GGTAAAGATCCACA 1136 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 111265965 Database: Eche_v2.0_cds.fasta Posted date: Jul 17, 2024 4:51 PM Number of letters in database: 37,600,338 Number of sequences in database: 30,099 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5