BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Eche_v2.0_cds.fasta 30,099 sequences; 37,600,338 total letters Query= Untitled_sequence Length=20 Score E Sequences producing significant alignments: (Bits) Value Erche06g030400.1.mRNA1.mrna1gene=Erche06g030400.1.mRNA1 38.1 4e-04 >Erche06g030400.1.mRNA1.mrna1 gene=Erche06g030400.1.mRNA1 Length=2955 Score = 38.1 bits (20), Expect = 4e-04 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 CAGAGCACGGGTCATCGATT 20 |||||||||||||||||||| Sbjct 1100 CAGAGCACGGGTCATCGATT 1119 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 111265965 Database: Eche_v2.0_cds.fasta Posted date: Jul 17, 2024 4:51 PM Number of letters in database: 37,600,338 Number of sequences in database: 30,099 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5