BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Erysimum V2.0 CDS 30,099 sequences; 37,600,338 total letters Query= Untitled_sequence Length=22 Score E Sequences producing significant alignments: (Bits) Value Erche05g016400.1.mRNA1.mrna1gene=Erche05g016400.1.mRNA1 41.7 4e-05 Erche02g008560.1.mRNA1.mrna1gene=Erche02g008560.1.mRNA1 28.8 0.31 >Erche05g016400.1.mRNA1.mrna1 gene=Erche05g016400.1.mRNA1 Length=3396 Score = 41.7 bits (22), Expect = 4e-05 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 1 TAGAAGTGAGGCAAATACTCGG 22 |||||||||||||||||||||| Sbjct 2902 TAGAAGTGAGGCAAATACTCGG 2923 Score = 39.9 bits (21), Expect = 1e-04 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Plus Query 2 AGAAGTGAGGCAAATACTCGG 22 ||||||||||||||||||||| Sbjct 1047 AGAAGTGAGGCAAATACTCGG 1067 >Erche02g008560.1.mRNA1.mrna1 gene=Erche02g008560.1.mRNA1 Length=1533 Score = 28.8 bits (15), Expect = 0.31 Identities = 17/18 (94%), Gaps = 0/18 (0%) Strand=Plus/Plus Query 2 AGAAGTGAGGCAAATACT 19 |||||| ||||||||||| Sbjct 1041 AGAAGTCAGGCAAATACT 1058 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 148234224 Database: Erysimum V2.0 CDS Posted date: Oct 20, 2020 1:06 PM Number of letters in database: 37,600,338 Number of sequences in database: 30,099 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5