BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Eche_v2.0_cds.fasta 30,099 sequences; 37,600,338 total letters Query= Untitled_sequence Length=20 Score E Sequences producing significant alignments: (Bits) Value Erche07g009500.1.mRNA1.mrna1gene=Erche07g009500.1.mRNA1 38.1 4e-04 Erche07g009480.1.mRNA1.mrna1gene=Erche07g009480.1.mRNA1 38.1 4e-04 Erche03g032390.1.mRNA1.mrna1gene=Erche03g032390.1.mRNA1 32.5 0.018 Erche08g014360.1.mRNA1.mrna1gene=Erche08g014360.1.mRNA1 27.0 0.84 Erche05g002330.1.mRNA1.mrna1gene=Erche05g002330.1.mRNA1 27.0 0.84 Erche01g024050.1.mRNA1.mrna1gene=Erche01g024050.1.mRNA1 27.0 0.84 Erche01g035760.1.mRNA1.mrna1gene=Erche01g035760.1.mRNA1 27.0 0.84 Erche01g035780.1.mRNA1.mrna1gene=Erche01g035780.1.mRNA1 27.0 0.84 Erche01g035790.1.mRNA1.mrna1gene=Erche01g035790.1.mRNA1 27.0 0.84 >Erche07g009500.1.mRNA1.mrna1 gene=Erche07g009500.1.mRNA1 Length=1488 Score = 38.1 bits (20), Expect = 4e-04 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCCA 20 |||||||||||||||||||| Sbjct 901 GAAGATTACAGATACTTCCA 882 >Erche07g009480.1.mRNA1.mrna1 gene=Erche07g009480.1.mRNA1 Length=8238 Score = 38.1 bits (20), Expect = 4e-04 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCCA 20 |||||||||||||||||||| Sbjct 820 GAAGATTACAGATACTTCCA 801 Score = 38.1 bits (20), Expect = 4e-04 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCCA 20 |||||||||||||||||||| Sbjct 7687 GAAGATTACAGATACTTCCA 7668 Score = 32.5 bits (17), Expect = 0.018 Identities = 19/20 (95%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCCA 20 ||||||| |||||||||||| Sbjct 3628 GAAGATTGCAGATACTTCCA 3609 Score = 30.7 bits (16), Expect = 0.065 Identities = 18/19 (95%), Gaps = 0/19 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCC 19 ||||||| ||||||||||| Sbjct 2161 GAAGATTGCAGATACTTCC 2143 Score = 27.0 bits (14), Expect = 0.84 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCCA 20 ||||||| || ||||||||| Sbjct 5251 GAAGATTGCATATACTTCCA 5232 >Erche03g032390.1.mRNA1.mrna1 gene=Erche03g032390.1.mRNA1 Length=2571 Score = 32.5 bits (17), Expect = 0.018 Identities = 19/20 (95%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCCA 20 |||||||||| ||||||||| Sbjct 904 GAAGATTACATATACTTCCA 885 >Erche08g014360.1.mRNA1.mrna1 gene=Erche08g014360.1.mRNA1 Length=690 Score = 27.0 bits (14), Expect = 0.84 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 2 AAGATTACAGATACTTC 18 |||||||||||| |||| Sbjct 45 AAGATTACAGATTCTTC 29 >Erche05g002330.1.mRNA1.mrna1 gene=Erche05g002330.1.mRNA1 Length=1284 Score = 27.0 bits (14), Expect = 0.84 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 3 AGATTACAGATACTTCC 19 |||||||||| |||||| Sbjct 573 AGATTACAGAAACTTCC 589 >Erche01g024050.1.mRNA1.mrna1 gene=Erche01g024050.1.mRNA1 Length=1878 Score = 27.0 bits (14), Expect = 0.84 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 1 GAAGATTACAGATACTT 17 |||| |||||||||||| Sbjct 1633 GAAGCTTACAGATACTT 1649 >Erche01g035760.1.mRNA1.mrna1 gene=Erche01g035760.1.mRNA1 Length=6111 Score = 27.0 bits (14), Expect = 0.84 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCCA 20 ||||||| || ||||||||| Sbjct 796 GAAGATTGCATATACTTCCA 777 Score = 27.0 bits (14), Expect = 0.84 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCCA 20 ||||||| || ||||||||| Sbjct 2323 GAAGATTGCATATACTTCCA 2304 Score = 27.0 bits (14), Expect = 0.84 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCCA 20 ||||||| || ||||||||| Sbjct 3577 GAAGATTGCATATACTTCCA 3558 >Erche01g035780.1.mRNA1.mrna1 gene=Erche01g035780.1.mRNA1 Length=789 Score = 27.0 bits (14), Expect = 0.84 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCCA 20 ||||||| || ||||||||| Sbjct 379 GAAGATTGCATATACTTCCA 360 >Erche01g035790.1.mRNA1.mrna1 gene=Erche01g035790.1.mRNA1 Length=2337 Score = 27.0 bits (14), Expect = 0.84 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 1 GAAGATTACAGATACTTCCA 20 ||||||| || ||||||||| Sbjct 1762 GAAGATTGCATATACTTCCA 1743 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 111265965 Database: Eche_v2.0_cds.fasta Posted date: Jul 17, 2024 4:51 PM Number of letters in database: 37,600,338 Number of sequences in database: 30,099 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5