BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Eche_v2.0_cds.fasta 30,099 sequences; 37,600,338 total letters Query= Untitled_sequence Length=20 Score E Sequences producing significant alignments: (Bits) Value Erche06g002390.1.mRNA1.mrna1gene=Erche06g002390.1.mRNA1 36.2 0.001 Erche06g008220.1.mRNA1.mrna1gene=Erche06g008220.1.mRNA1 32.5 0.018 Erche06g008760.1.mRNA1.mrna1gene=Erche06g008760.1.mRNA1 30.7 0.065 Erche01g023700.1.mRNA1.mrna1gene=Erche01g023700.1.mRNA1 30.7 0.065 Erche08g016005.1.mRNA1.mrna1gene=Erche08g016005.1.mRNA1 28.8 0.23 Erche08g016000.1.mRNA1.mrna1gene=Erche08g016000.1.mRNA1 28.8 0.23 Erche04g026280.1.mRNA1.mrna1gene=Erche04g026280.1.mRNA1 28.8 0.23 Erche03g023340.1.mRNA1.mrna1gene=Erche03g023340.1.mRNA1 28.8 0.23 Erche04g019500.1.mRNA1.mrna1gene=Erche04g019500.1.mRNA1 27.0 0.84 Erche03g015530.1.mRNA1.mrna1gene=Erche03g015530.1.mRNA1 27.0 0.84 Erche03g017700.1.mRNA1.mrna1gene=Erche03g017700.1.mRNA1 27.0 0.84 >Erche06g002390.1.mRNA1.mrna1 gene=Erche06g002390.1.mRNA1 Length=957 Score = 36.2 bits (19), Expect = 0.001 Identities = 19/19 (100%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 2 AAGAGTTGTAGATTGCGAT 20 ||||||||||||||||||| Sbjct 151 AAGAGTTGTAGATTGCGAT 169 >Erche06g008220.1.mRNA1.mrna1 gene=Erche06g008220.1.mRNA1 Length=1197 Score = 32.5 bits (17), Expect = 0.018 Identities = 19/20 (95%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 AAAGAGTTGTAGATTGCGAT 20 ||||||||||||| |||||| Sbjct 150 AAAGAGTTGTAGACTGCGAT 169 >Erche06g008760.1.mRNA1.mrna1 gene=Erche06g008760.1.mRNA1 Length=870 Score = 30.7 bits (16), Expect = 0.065 Identities = 18/19 (95%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 2 AAGAGTTGTAGATTGCGAT 20 ||||||||||||||| ||| Sbjct 151 AAGAGTTGTAGATTGAGAT 169 >Erche01g023700.1.mRNA1.mrna1 gene=Erche01g023700.1.mRNA1 Length=723 Score = 30.7 bits (16), Expect = 0.065 Identities = 18/19 (95%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 2 AAGAGTTGTAGATTGCGAT 20 ||||||||||||||| ||| Sbjct 151 AAGAGTTGTAGATTGAGAT 169 >Erche08g016005.1.mRNA1.mrna1 gene=Erche08g016005.1.mRNA1 Length=666 Score = 28.8 bits (15), Expect = 0.23 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 1 AAAGAGTTGTAGATT 15 ||||||||||||||| Sbjct 168 AAAGAGTTGTAGATT 182 >Erche08g016000.1.mRNA1.mrna1 gene=Erche08g016000.1.mRNA1 Length=762 Score = 28.8 bits (15), Expect = 0.23 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 1 AAAGAGTTGTAGATT 15 ||||||||||||||| Sbjct 168 AAAGAGTTGTAGATT 182 >Erche04g026280.1.mRNA1.mrna1 gene=Erche04g026280.1.mRNA1 Length=825 Score = 28.8 bits (15), Expect = 0.23 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 1 AAAGAGTTGTAGATT 15 ||||||||||||||| Sbjct 150 AAAGAGTTGTAGATT 164 >Erche03g023340.1.mRNA1.mrna1 gene=Erche03g023340.1.mRNA1 Length=921 Score = 28.8 bits (15), Expect = 0.23 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 2 AAGAGTTGTAGATTG 16 ||||||||||||||| Sbjct 154 AAGAGTTGTAGATTG 168 >Erche04g019500.1.mRNA1.mrna1 gene=Erche04g019500.1.mRNA1 Length=882 Score = 27.0 bits (14), Expect = 0.84 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 AAAGAGTTGTAGATTGCGAT 20 ||| |||||||||||| ||| Sbjct 171 AAAAAGTTGTAGATTGAGAT 190 >Erche03g015530.1.mRNA1.mrna1 gene=Erche03g015530.1.mRNA1 Length=624 Score = 27.0 bits (14), Expect = 0.84 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 AAAGAGTTGTAGATTGCGAT 20 |||||| ||||||||| ||| Sbjct 174 AAAGAGCTGTAGATTGAGAT 193 >Erche03g017700.1.mRNA1.mrna1 gene=Erche03g017700.1.mRNA1 Length=1023 Score = 27.0 bits (14), Expect = 0.84 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 AAAGAGTTGTAGATTGCGAT 20 ||| |||||||||||| ||| Sbjct 150 AAAAAGTTGTAGATTGAGAT 169 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 111265965 Database: Eche_v2.0_cds.fasta Posted date: Jul 17, 2024 4:51 PM Number of letters in database: 37,600,338 Number of sequences in database: 30,099 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5